# INTRODUCTION As stated in the above-mentioned paper: "As physics, chemistry and biology, human conceptual science is also developing, that is to say, mathematics, logic and psychology are also developing. On the basis of experimental methods, human beings should also seek more progress in tool science. From Klein's Ancient and Modern Mathematical Thoughts [4], we can see that mathematics is developing. Logic, like mathematics, is also developing. From Aristotle's syllogism logic to the development of modern logic and contemporary logic, the development of logic is also fascinating. In logic, Hegel's Logic [5] is unique, and Wittgenstein's Philosophy of Logic [6] makes an in-depth analysis of logic. As for the development history of logic, Niels' The Development of Logic [7] depicts the development course of logic, and China logician Jin Yuelin's simple logic theory Logic [8] and Zhu Zhikai's Logic and Method [9] also have unique insights. " "TongYi Logic" is a strict logical science system based on the previous logic and demonstrated by philosophy and science, and it is not a subjective conclusion. London Journal of Engineering Research # II. QUOTATION OF THE TWELVE SYSTEM LOGIC [10] RULES OF "TONGYI LOGIC" SYSTEM It is the establishment of unified logic that leads to a new idea of DNA production in biology. That is, DNA has a rules of origin, which is the DNA production table or the DNA production cycle table. In TongYi's logic, there are twelve system logics that reveal the laws of the generation of things. As long as the conditions comply with the Yin Yang law, BianZheng positive law, and TongYiTi law, they can generate twelve systems. And the DNA system precisely meets this logical condition, so it is a complete generation system of twelve systems. Twelve System Logic tables are expressed as follows, in which the name of the product in the table is the totlename of its properties: 104? 103? 102? 101? 100? 99?? 98? 97? 40?? 39?? 38? 37? 36? 35? 34? 33? ? 96? 95? 94?? 93?? 92? 91? 90?? 89?? 32? 31? 30? 29? 28? 27? 26? 25æ¯?" ? 88? 87? 86?? 85?? 84? 83? 82? 81? 24? 23? 22? 21?? 20? 19? 18? 17? ? 80? 79? 78?? 77? 76? 75? 74? 73? 16? ?S 15? ?P 14?? ?Si 13?? é?"Al 12? ?Mg 11? ?Na 10? ?Ne 09? ?F ?(a new system of upper and lower dialectics) 72?? 71?? 70? 69?? 68?? 67? 66? 65? 08?? 07? 06? 05? 04? 03? 02? 01? The relative attributes of yin and yang within the upper and lower 64 hexagrams are as follows: ?? ? ????åº?"?? ?? ???????? ????????? ??? ???????? ??????? ?? ??????? ???????? ?? ???????? æ¯?"??????? ??? ????????? ??????? ?? ???????? ????????? ?? ??????? ??????? ??? ????????? ???????? According to the ShiErXiTong logic, the above table follows the "ShiErXiTongHouBianZheng logic" and the "ShiErXiTongHouBianZheng TongYi logic ", i.e. Based on (Gan 1+ Gan 2+ Li 1 dialectical Li 2+ Zhen 1 dialectical zhen 2), driven by (Dui 1+ Dui 2+ Gen 1+ Gen 2), and (Kun 1+ Kun 2+ Kan 1 dialectical Kan 2+ Xun 1 Dialectical Xun 2) for leading. The three BianZheng are unified in the "unity" of the total system composed of twelve systems. At the same time, these twelve systems follow the "ShiErXiTong-HouSiXiang logic" and "ShiErXiTongHouWu-Xiang logic" etc. # III. THE CALCULATION PROCESS OF DNA GENERATION PERIODIC TABLE The analysis process is as follows: First, the two major contradictions between yin and yang in the production of DNA. yin and yang are the state properties of things, with yin representing passive properties and yang representing active properties. The contradiction between yin and yang is the contradiction between deoxyribose and phosphoric acid, which is the chemical bond connection mode, and the contradiction between deoxyribose and base, which is the chemical bond connection mode. Phosphoric acid is a basic substance, and deoxyribose is a driving factor of the two contradictions. Phosphoric acid and base are connected by chemical bonds, which is also the "yang" factor. That is to say, the chemical bond between deoxyribose and phosphoric acid is yang, while the chemical bond between deoxyribose and base is yin. Thus, these two contradictions are opposite to each other. Correspondingly, when the yang contradiction drives the DNA basic BianZZheng, it generates the basic form of the yang system, while the yin contradiction generates the basic form of the yin system. The interaction of these two contradictions will form the basic image of DNA, which constitutes the state mechanism of the positive movement of deoxyribose, which is the four images. The unity of these two contradictions is DNA properties, which is expressed through the sequence of DNA. It realizes the change of image state by the way of deoxyribose rotating four bases, and the performance of this image state is the arrangement order of A, T, C and G. That is to say, these four bases are the four images of DNA. # Second, what is the composition mechanism of the basic form of DNA? As we known, the mechanism of increasing the yang of atoms in the atomic system is that during the process of increasing protons, electrons construct the properties of an atom through the operation of outer orbits. Similarly, the 128 basic forms of DNA construct a basic DNA properties through the DNA sequence of base operation. Here, the three elements of DNA form a certain base sequence by forming three nucleotides to complete the production of 128 basic forms of DNA. This can be verified by the correspondence between DNA and protein, that is, the codon of protein is composed of three bases. This is only a function of the basic form. In fact, the same codon may have other functions, which is also proved by experiments. This mechanism is the differentiation between deoxyribose, phosphate, and base with the increase of deoxyribose, and its effect is unified in the newly formed DNA sequence, which is a form of "unity". Therefore, this order is not a single element of deoxyribose at work, but a unified result of BianZheng. Instead, phosphate, base, and deoxyribose correspond to four elephantine state changes, and form a three element form with each other, that is, each element has four elephantine state changes, thus BianZheng forms a certain three element form. In this way, the combination of the three elements and the four phenomena forms exactly the 64 forms, driven by the changes in the yin and yang states, and forms the 64 forms corresponding to the inside and outside, thus forming the twelve systems and forming the 128 forms. Specifically, phosphate, base, and deoxyribose form nucleotides, and the four dimensional changes of the four bases of nucleotides are reflected in the three elements, with changes in yin and yang, resulting in the formation of a twelve DNA system, which forms one hundred and twenty-eight basic DNA forms. This nucleotide mechanism is the morphological mechanism of the three elements, which means that during the formation of morphology, it can only be the BianZhang morphological mechanism of three nucleotides linked between the three elements. Therefore, the triad mechanism is There are two mechanisms for the formation of such DNA, namely, two basic contradictory chemical bonds, and two sixty-four basic morphological systems of yin and yang. # London Journal of Engineering Research These two systems are in the functional structure of DNA. If it is a basic morphological system, it is a double-stranded structure with opposite yin and yang. For the DNA structure of life, it is a double helix structure of yin and yang. The sequence of DNA also shows the yin and yang of this double helix and double strand. One direction in a DNA molecule is 5'?3', and the other direction is 3'?5'. Moreover, DNA polymerase in organisms can only catalyze DNA synthesis from the direction of 5'?3'. The two strands of DNA are divided into yin and yang under the unified properties, and the positive properties is established on the basis of negative. That is to say, the basic form of DNA on the positive chain is defined in the order of its corresponding increase in yang value. The same codon in the two chains actually represents different properties of yin and yang, and they are completely different basic forms of DNA in the unity property of DNA, just like the property differentiation of atomic system. If it must be expressed by codon, it should be the basic form of positive DNA followed by the negative triplet code and the corresponding positive triplet code. Compared with the atomic properties formed by the mechanism that the electrons in the atomic system run along a certain orbit and suborbital, the "electrons" or "bases" of DNA living bodies are established by using the arrangement order of four bases at three positions where three deoxyriboses are formed. This is the secret of how DNA works. So it shows that any form of DNA is based on a "triplet" as the basic unit. This "triplet" is a piece of DNA composed of three adjacent nucleotides. In other words, any DNA is based on "triplet". Third, what is the unity property of the basic form of DNA? It is the base sequence representing 128 basic genetic properties. Forth, the functional structure of DNA. This does not refer to the morphology of 128 basic genes, but to the DNA of the functional structure of a living body. The DNA of any functional structure is a "compound" of basic genes, and RNA is just a product of DNA. So, what is the structure of DNA? It includes at least three aspects, namely, DNA unity, DNA material form system, DNA movement form system and DNA thought form system. For a living body, DNA includes the psychological state of all living individuals, and it is distributed in the twelve systems of living body in the functional differentiation of living body. Therefore, all the properties of individual life are reflected in the DNA system. The DNA system here refers to the functional structure of DNA of living individuals. Because DNA contains all the psychological states of a living individual, it forms the DNA of the twelve major systems corresponding to the twelve major systems of the living individual. Of course, this still needs to be tested through experiments. Here we can make a theoretical prediction that DNA is a unified class set system with all psychological class sets, ultimately associated with the phenotypes generated by BianZZheng of living individuals, thus forming the overall structure of living individuals. Then, the standard pattern of DNA can be described by conceptual unification. It is expressed by "the cycle table of concept unification". The fifth is the basic unit level of life based on DNA. At this level, for some non-cellular life, it London Journal of Engineering Research may be DNA, or RNA's BianZZheng, together with the individual's functional structure, to form a living body. For cellular organisms, prokaryotes directly form functional structures, while eukaryotes undergo cell division, which can form the BianZZheng of cells, thus forming the basic unit of a living organism, forming the "type and type" structure of their own cellular units.Sixth, the image relationship of DNA. The form of DNA is four bases. So, which one is shaoyang, shaoyin, laoyang and laoyin? Cipher has two startup codes, namely AUG and GUG. Among these two startup codes, we investigate the most common AUG startup code. This promoter code refers to the codon of mRNA, which is reflected in the code of "nonsense strand" DNA as TAC. That is to say, in the process of DNA deoxyribose and base connection, it is generated in protein. Deoxyribose first shows the combination with T, which reflects the foundation of T's yang, that is to say, T is shaoyang, which is the basis for the increase of yang, and then the opposite base is A, shaoyin, and then C and G, which are opposite to each other. Then, purine and pyrimidine each have a yin and a yang, so C is Taiyin and G is Taiyang. Their order properties is their unity, so adenine, guanine, unity order, thymine and cytosine constitute the five-element relationship of wood, fire, earth, gold and water. Seventh, the sequencing of the basic forms of DNA. The basic form of DNA is a "triplet" sequence, so how is this sequence sorted? If we sort by yang? This can be derived from the following DNA cycle table and is consistent with the existing "triplet" properties. The six lines in the DNA periodic table can be replaced with corresponding A, T, C, and G to obtain the triplet code. How to replace it? The triad is actually the BianZheng of the three noumenons, namely the BianZheng of material form, motion form, and thinking form. In this way, the upper two lines, the middle two lines, and the lower two lines are respectively symbolic states. According to the table below, simply substitute it in. The order is concerned, because the cycle table has already discharged the order, which is known. What I want to talk about here is the codon of RNA, which is not 128 basic forms. It is a derivative of the basic form of DNA and cannot replace DNA itself. RNA is not qualified to be the basic form of DNA. # G guanine T thymine C cytosine A adenine The question is the order of DNA triplet the same as that of hexagrams? This is based on the cycle table of the universe. As can be seen from the start code of codon, it corresponds to the first position in the cycle table, that is, the beginning. In this way, it is a hurdle. Then, after conversion, it is found that if the triplet of DNA is based on the upper, middle and lower levels, it is the lower level in front, the upper level and the middle level in the back, so the order of yang of codons should be changed to be consistent with that of hexagrams. The positions of the last two bases of the triplet can be reversed, so that the order of increasing the yang of the hexagrams is "three hexagrams" (this means that the triplet is regarded as three hexagrams, that is, two adjacent hexagrams form an image, and an image as a whole is regarded as one hexagram.), the order of the first (lower), middle and upper. There is a question here, that is, is the rules of this codon universal? Yes, we mentioned earlier that the mechanism of DNA morphogenesis is the triplet mechanism. Eighth, the cycle table of DNA production (abbreviated as DNA cycle table). In the "living body" system, the most basic "shaped" table is the "DNA cycle table". As we known, DNA is driven by the contradiction between deoxyribose, phosphoric acid and base, that is, the contradiction between deoxyribose and phosphoric acid, and the contradiction between deoxyribose and base, thus forming two internal and external systems of DNA, that is, yin and yang, thus forming two eight systems, and then forming twelve dialectical systems of the two systems. # London Journal of Engineering Research # We give the cycle table of DNA here According to the unified naming method of the cycle table of the Universe, namely "serial number+hexagram name+basic form", we give these 128 basic forms of genes a unified name: "serial number+hexagram name+gene", for example, 128 Kan, its name is "128 Kan gene", and another example is 127 Shi, its name is "127 Shi gene". Among them, the names of hexagrams are arranged in the order of upper hexagram, middle hexagram and lower hexagram. In the table, we use the "triple code". Although the names of the 64 hexagrams are the same, their properties are that the first 64 hexagrams are yang and the last 64 hexagrams are Yin, and their properties are different. The yin-yang mechanism under the same name is completed by DNA unity and appears as double-stranded yin-yang. 3![Table that Produces DNA | | Volume 23 Issue 2 ?"? Compilation 1.0 © 2023 Great ] Britain Journals Pressnecessary and cannot be two nucleotides or three nucleotides. In layman's terms, it is a hexagram in the form of six trigrams, with each adjacent two trigrams forming one image. Such a hexagram can only consist of three such BianZhang forms. Therefore, the triad mechanism is the morphogenetic mechanism of DNA.](image-2.png "3 A") 5![Table that Produces DNA 5 | | Volume 23 Issue 2 ?"? Compilation 1.0 © 2023 Great ] Britain Journals Press](image-3.png "5 A") 1upper hexagra????????lowest hexagra128?127?126?125?124?123?122?121???(a new system ofupper and lower64?63??62??61?60??59?58?57??dialectics)?120æ¯?"119?118?117?116?115?114?113?56??55?54??53??52?51??50?49??(a new system of112?111?110?109?108??107?106?105??upper and lower48?47?46?45?44?43?42??41?dialectics)?(a new system ofupper and lowerdialectics) 2upper hexagramkankunzhenxunqianduigenlilowest hexagram122128 kan127 shi126 xie125 huan124 song123 kun121 weijimengkan (a new systemACTCCTCTTGCTGTTATTTTTTCTof upper and lower6360dialectics)64 li62 jiaren61 feng59 bi58 ge57 jijitongrenmingyiTGAGAACGATAAAGAAAAGGACAA120 bi119 kun118 yu117 guan116 pi115 cui114 bo113 jinLondon Journal of Engineering Researchkun zhen (a new system of upper and lower dialectics) xun (a new system of upper and lower dialectics)ACC 56 dayou TGG 112 zhen ACA 48 ding TGT jing 104 AAT 40 shike TTACCC 55 qian GGG 111 fu CCA 47you GGT 103 sheng CAT 39wuwa ngCTC 54 xiaochu GAG 110 zhen CTA 46 xun CAT 102 heng CGT 38 yi GCAGCC 53 dazhuan g CGG 109 yi GCA 45 heng CGT 101 xun CAT 37 zhen CTAGTC 52 tai CAG 108wuw ang 44 sheng CAT 100 you GGT 36 fu CCAATC 51 dachu TAG 107 sui ATA 43 gu TAT daguo 99% AGT 35 yi TCATCC 50 guai AGG 106 yi TCA daguo 42 AGT 98 gu TAT 34 sui ATATTC 49 xu AAG 105 shike jing 41 AAT 97 ding TGT 33 zhen ACAGTA9493908996 xu95 taidazhuan92 qian91 guaixiaochudachudayouAAGCAGgGGGAGGqianGAGTAGTGGCGG32 jin31 pi30 guan29 yu28 kun27 bo26 cui25biTTCGTCGCCCTCCCCTCCATCACC8685jie 8887 lin84lu83dui82 yang81 kuiguimeizhongfuACGCCGGTGATGTCGTTGCTGGCGdui2124 lu23 dun22 jian20 qian19 gen18 xian17 jianxiaoguoTGCGGCGACCACTACAGCAACGCG78gen80 jian79 qian77 jian76 dun75 xian74 gen73 luxiaoguoA Table that Produces DNA6| Volume 23 Issue 2 ?"? Compilation 1.0 |© 2023 Great ] Britain Journals Press 7 A Table that Produces DNA 6 7 A Table that Produces DNA | | © 2023 Great ] Britain Journals Press Volume 23 Issue 2 ?"? Compilation 1.0 * Advances in Chemical Engineering and Science 2022 ?Scientific Research Publishing Inc. USA * TongYiLun Thought WangXijia WuJianxun China * JianxunWu Object and conceptual Science and The essence of Mathematics. CHINA INTERNATIONAL PRESS? BEAVERTON, OREGON USA 2020 * Ancient and Modern Mathematical Thought Klein 1981 Shanghai Science and Technology Press * LogicHegel 1976 Commercial Press 12 * On Logical Philosophy Wittgenstein February, 1996 Commercial Press * MarthaNiel Niel November 1985 Development of Logic, Commercial Press * JinYuelin Logic April 2010 China Renmin University Press * Logic and Method, People's Publishing House ZhuZhikai 2003 * JianxunWu Object and conceptual Science and The essence of Mathematics. CHINA INTERNATIONAL PRESS? BEAVERTON, OREGON USA 2020 * JianxunWu Object and conceptual Science and The essence of Mathematics. CHINA INTERNATIONAL PRESS? BEAVERTON, OREGON USA 2020